CAGL0M07788r


tRNA Glu (TTC)

Genomic environment map

Element type: tRNA
Element length: 72 nucleotides,
on anti-sense strand of
Cagl0M: complement(783270..783341).

Computed results  

None available yet


Sequence data  


Nucleotide sequence    

>CAGL0M07788r.nt
TCCGATATAGTGTAACGGCTATCACATCACGCTTTCACCGTGGAGACCGGGGTTCGACTC
CCCGTATCGGAG




Legend and notes  


Lengths
The length, in codons, of coding sequences includes the stop codon, hence it is one unit longer than the protein length.

Genomic environment map
Click on the symbol of an element or a family to go to its corresponding page. Colors in the lane "protein encoding genes" indicate strandedness: shades of blue for direct orientation, shades of red for reverse orientation. Colors in the lane "protein family" are arbitrarly chosen in such a way that different protein families have different colors in the map.

Protein domain map
Domains are extracted from SwissProt files. Click on the symbol of a domain to extract the domain sequence.

Genemark image and list
Genemark computation of protein-coding potential of DNA was made from 1000 nucleotides upstream the open reading frame to 300 nucleotides downstream. Thus the open reading frame protein-coding potential appears on frame #3.

Sequences
ColorNucleotide sequence and Coding sequencePredicted translation product
REDstart and stop codonsInitial methionine and sequence end
BLUEcoding sequenceprotein sequence
greynon-coding sequence (upstream, downstream or intron)
greydonor and acceptor splicing sites